Classification of archaic rice grains excavated at the Mojiaoshan site within the Liangzhu site complex reveals an Indica and Japonica chloroplast complex

Table 2 Primer information used in this study and sequence polymorphism detected by using their primers

Genome		Gene name^a	Application	Forward (F), Reverse (R) Primer (5′ to 3′)^b		Position (bp)^a	Product size (bp)^a,c	Polymorphism
Genome		Gene name^a	Application	Forward (F), Reverse (R) Primer (5′ to 3′)^b		Position (bp)^a	Product size (bp)^a,c	Type	Sequence^d
Chloroplast		rps16 intron1:	Ancient rice	F2	CCTTATTCCGGTCCAATTCTA	4946-4966	152	In/del	+ 7 bp
		OsC01	Modern rice	R2	GGGTATGTTGCTACTCTTTTGAA	5097-5075
		Orf100	Ancient rice	F1	TGGATTTCGAAAGTCAATTTT	8500-8520		In/del	−69 bp
			Modern rice	R1	CCTTTTCCCACTCGCTCTCTA	8599-8579	100
			Modern rice	R2	TCCATGATTCCTATTTCCAAG	8661-8641	162
		trnI:	Ancient rice	F	TCGATTCTCTCCGTTTAACTTT	14,116-14,137	152	SNP	A/G
		14,169	Modern rice	R	GGGAAGAACTTTTGGTAATGG	14,267-14,247
		petN-trnC:	Ancient rice	F2	ATCAGTTCAAAGAATTTACTC	17,758-17,778	75	In/del	+ 32 bp
		I-32	Modern rice	R2	TATTTATACTTAATGCTCCCC	17,832-17,812
Nuclear	chr. 1	qSH1 promoter	Ancient rice	F	ATGGTATTGATGTATACTGGA	38,217,614-38,217,634	71	SNP	G/T
	chr. 1	qSH1 promoter	Ancient rice	R	CATCTCGTCCAAAGATCCTTA	38,217,684-38,217,664
	chr. 4	sh4 exon1	Ancient rice	F	AGACGCTCATCCTCATCACC	34,631,533-34,631,552	142	SNP	G/T
	chr. 4		Modern rice	R	TAGTTCTCCACCCACTTCCAC	34,631,431-34,631,411
	chr. 6	Non-cording region: DJ6	Ancient rice	F1	TGACCGGTTCTGTAGCAGTG	9,043,039-9,043,058		In/del	+ 217 bp
			Modern rice	R1	CCAGTTTAATGTTTTYTCATTGCC	9,043,136-9,043,113	98
			Modern rice	R2	GATTTTCCGTTTTCCGTGCC	–	NA

^aGene name, position and product size were referred to chloroplast genome (accession No. NC_001320) and nuclear genome of chromosome no.1, 4 and 6 (accession No. NC_008394, NC_008397, NC_008399) in Japonica ‘Nipponbare’
^bThe specific forward primer was F1 for specific reverse primers, R1 and R2, in Orf100 region and DJ6 region. Y = C or T
^c″NA” indicated PCR amplification was not successful with specific forward and reverse primer set
^dNumerical number indicates insertion or deletion length corresponding with Japonica ‘Nipponbare’ sequence. SNP sequence shows about wild type or mutant type by “wild-type sequence/mutant-type sequence” in a cell

ISSN: 2661-8974