Skip to main content

Table 2 Primer information used in this study and sequence polymorphism detected by using their primers

From: Classification of archaic rice grains excavated at the Mojiaoshan site within the Liangzhu site complex reveals an Indica and Japonica chloroplast complex

Genome Gene namea Application Forward (F), Reverse (R) Primer (5′ to 3′)b Position (bp)a Product size (bp)a,c Polymorphism
Type Sequenced
Chloroplast rps16 intron1: Ancient rice F2 CCTTATTCCGGTCCAATTCTA 4946-4966 152 In/del + 7 bp
OsC01 Modern rice R2 GGGTATGTTGCTACTCTTTTGAA 5097-5075    
Orf100 Ancient rice F1 TGGATTTCGAAAGTCAATTTT 8500-8520   In/del −69 bp
Modern rice R1 CCTTTTCCCACTCGCTCTCTA 8599-8579 100   
R2 TCCATGATTCCTATTTCCAAG 8661-8641 162   
trnI: Ancient rice F TCGATTCTCTCCGTTTAACTTT 14,116-14,137 152 SNP A/G
14,169 Modern rice R GGGAAGAACTTTTGGTAATGG 14,267-14,247    
petN-trnC: Ancient rice F2 ATCAGTTCAAAGAATTTACTC 17,758-17,778 75 In/del + 32 bp
I-32 Modern rice R2 TATTTATACTTAATGCTCCCC 17,832-17,812    
Nuclear chr. 1 qSH1 promoter Ancient rice F ATGGTATTGATGTATACTGGA 38,217,614-38,217,634 71 SNP G/T
R CATCTCGTCCAAAGATCCTTA 38,217,684-38,217,664    
chr. 4 sh4 exon1 Ancient rice F AGACGCTCATCCTCATCACC 34,631,533-34,631,552 142 SNP G/T
  Modern rice R TAGTTCTCCACCCACTTCCAC 34,631,431-34,631,411    
chr. 6 Non-cording region: DJ6 Ancient rice F1 TGACCGGTTCTGTAGCAGTG 9,043,039-9,043,058   In/del + 217 bp
Modern rice R1 CCAGTTTAATGTTTTYTCATTGCC 9,043,136-9,043,113 98   
R2 GATTTTCCGTTTTCCGTGCC NA   
  1. aGene name, position and product size were referred to chloroplast genome (accession No. NC_001320) and nuclear genome of chromosome no.1, 4 and 6 (accession No. NC_008394, NC_008397, NC_008399) in Japonica ‘Nipponbare’
  2. bThe specific forward primer was F1 for specific reverse primers, R1 and R2, in Orf100 region and DJ6 region. Y = C or T
  3. c″NA” indicated PCR amplification was not successful with specific forward and reverse primer set
  4. dNumerical number indicates insertion or deletion length corresponding with Japonica ‘Nipponbare’ sequence. SNP sequence shows about wild type or mutant type by “wild-type sequence/mutant-type sequence” in a cell