Skip to main content

Table 1 List of the internal reference genes and the amplification specifications in qRT-PCR

From: Evaluation of suitable reference genes for normalization of quantitative real-time PCR analysis in rice plants under Xanthomonas oryzae pv. oryzae--infection and melatonin supplementation

No Gene symbol Gene name GenBank accession No. Primer sequence (5′-3′), Fwd // Rev Amplicon size (bp)
1 18S 18S ribosomal RNA AF069218.1 CTACGTCCCTGCCCTTTGTACA//
ACACTTCACCGGACCATTCAA
213
2 25S 25S ribosomal RNA M11585.1 AAGGCCGAAGAGGAGAAAGGT//
CGTCCCTTAGGATCGGCTTAC
238
3 ACT Actin AB047313.1 CAGCCACACTGTCCCCATCTA//
AGCAAGGTCGAGACGAAGGA
184
4 β -TUB β – tubulin D30716.1 GCTGACCACACCTAGCTTTGG//
AGGGAACCTTAGGCAGCATGT
224
5 eEF-1a Eukaryotic elongation factor 1 - alpha GQ848073.1 TTCACTCTTGGTGTGAAGCAGAT//
CTTCCTTCACGATTTCATCGTAA
228
6 eIF-4a Eukaryotic initiation factor 4 - alpha AB046414.1 TTGTGCTGGATGAAGCTGATG//
GGAAGGAGCTGGAAGATATCATAGA
236
7 UBC Ubiquitin-conjugating enzyme E2 AK059694 CCGTTTGTAGAGCCATAATTGCA//
AGGTTGCCTGAGTCACAGTTAAGTG
188
8 UBQ-5 Ubiquitin 5 AK061988.1 ACCACTTCGACCGCCACTACT//
ACGCCTAAGCCTGCTGGTT
167
9 UBQ-10 Ubiquitin 10 AK101547 TGGTCAGTAATCAGCCAGTTTGG//
GCACCACAAATACTTGACGAACAG
192
10 GAPDH Glyceraldehyde – 3 – phosphate dehydrogenase GQ848049.1 AAGCCAGCATCCTATGATCAGATT//
CGTAACCCAGAATACCCTTGAGTTT
189