Skip to main content

Table 1 Molecular markers of SSIIa, SSIIIa and Wxmp genes used in this study

From: Effects of soluble starch synthase genes on eating and cooking quality in semi waxy japonica rice with Wxmp

Genes Primer sequences Product size (bp) Annealing temperature (°C)
SSIIa (L22) F: CTTTGATAGTTCGAATGGTT 251/248 55
R: CAATGTTTCTCCGTGATGAT
SSIIIa (L25) F: GAACTTGTGCCTTAAGCTGACTG 197/177 55
R: GGAATAGTAAGCCGAAGGACTT
Wxmp O-F: 5′-ATGTTGTGTTCTTGTGTTCTTTGCAGGC3′ 439/200 65
O-R: 5′-GTAGATCTTCTCACCGGTCTTTCCCCAA3′
I-F: 5′-GGGTGAGGTTTTTCCATTGCTACAATCG3′ 439/292 65
I-R: 5′-GTCGATGAACACACGGTCGACTCAAT3′