Skip to main content

Table 1 Primers used for real-time qPCR

From: Antiglycative and anti-inflammatory effects of lipophilized tyrosol derivatives

Gene Forward primer Reverse primer
IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT
IL-6 AGCCAGAGTCCTTCAGAGAGAT GCACTAGGTTTGCCGAGTAGAT
iNOS GGCAGCCTGTGAGACCTTTG GCATTGGAAGTGAAGCGTTTC
MIP2 CTGTCAATGCCTGAAGACC CCGGGTGCTGTTTGTTTT
TNF-α CACCACGCTCTTCTGTCTACTG CTTTGAGATCCATCGCGTTG
18 s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG