Skip to main content

Table 1 Oligonucleotide primers used for 16S rRNA sequencing

From: Phenotypic and phylogenetic characterization of Lactobacillus species isolated from traditional Lighvan cheese

Primer Sequence 5′- 3′ Reference
Hal 6F AGAGTTTGATC(AC)TGGCTCAG (Karlson et al., 1993)
Hal 6R TACCTTGTTAGGACTTCACC (Karlson et al., 1993)
Lac R AATCCGGATAACGCTTGCC This study